Transcription downloaded from https://sermons.northharris.freechurch.org/sermons/43846/30723-pm-gaelic/. Disclaimer: this is an automatically generated machine transcription - there may be small errors or mistranscriptions. Please refer to the original audio if you are in any doubt. [0:00] . . [0:16] . . . [0:28] . . . [0:39] . . . . . . [0:51] . . . . . . . . [1:03] . . . . . . [1:15] . . . . . [1:29] . . . . . . [1:41] . . . . [1:53] . . . . . . [2:05] . . . . . [2:19] . . . . . . [2:31] . . . . [2:44] . . . . . . [2:56] . . . . . . . [3:10] . . . . . . [3:22] . . . . . . . [3:36] . . . . . [3:48] . . . . . . . . . [4:00] . . [4:15] . . . . . . . CHOIR SINGS CHOIR SINGS [5:22] CHOIR SINGS CHOIR SINGS The Libeso, away people began to accept it. [5:32] I know that when you areental, you understand? [5:44] I don't just want to say nothing. You may be the good ones and you are the coming sites that have rested and become more right in the old Г Mobilisation. [6:08] And that is why. The daughter would be very proud of me because she knew the love of Hoxh In school. [6:39] I didn't enjoy it, but it couldn't… There only did they come and out of there and left it to the Wahr unamb esempio. Like this one… …he came to me. [6:52] And to hear it even toasted Gal Gadge. And as in time of it, these people have became superior to Asia, and of course theまり hall we took in those Withouthaven. [7:05] He hadinations and negotiations. He said, Don't deal with the bullshit. [7:22] And guys he kept busy living and his father's right there. He said, That metre means to give us what the power of God was with ouraga. [7:37] But for the vulnerable people as they were born and to get to our daughter them from our slaughterhouse at this time. [7:49] But one thing we had to start off getting through that 과 hemp field for her. I felt it's understood from us when she could she was there and we could just such a great way to the community, so it's always been important starting. [8:08] It's just a kind of school, it's really important. It's hard for me to get in many more sins, and I got many people here. [8:26] to us, ar induce the money for his wife, and course. [8:46] He let us know you already there, and he came to us. Rhyth Bha ahor m CEанach Halina sometimes получается Barakangim I go to cinema after every time. [9:20] We take it together with me. We go to cinema after every Buta then. Whoever goes in there then, just not only research my interest now, but recent ensured myself again now. [9:36] For example. I need to compare what it's like a beautiful festival. From now on, This state provided him When the Lord Rich was here spring, the manil who sail the sun was just born. [10:09] As he saw there, we had better hears Mr children. [10:24] On pocket. The first time he was 50 years old, the first time he was beaten. Theizитin 오�catagan 몸in làmicit nuestroscups. [10:36] Then we managed to destroy our ownvisible people, and we were lost in those countries So we checked away and we just went to work with the unknown people And we regulated these businesses After I experienced aneyed she would never even have a failed제 outragen But they would have to tell me More than for the whole district They would manage to live next June This was help Hungarian myth. [11:33] It wasn't a town for me, but they couldn'tCU get in my mind... [11:44] ffeine tris Reed semble not having my job is even broken I don't show up all of that You don't really stop but you don't really dokument I was hired for my time and take my meals too well Truth in my Republic I hope I stayed on essential Amen. [12:41] Amen. Amen. [13:41] Amen. Amen. [14:41] Amen. Amen. [15:41] Amen. Amen. [16:41] Amen. Amen. [17:41] Amen. Amen. [18:41] Amen. Amen. [19:22] I don't want the skill of an a print on this. It can be put on this can be used because if two you need to turn it down to our hands, I will thank you again, but it really was great. [19:45] You can wave together. Amen. My탄re Van El Limbe was on my way as for this man small sweet vom bleich Join Prof. [20:12] prints Thank you. [21:12] Thank you. [21:42] Thank you. [22:12] Thank you. [22:42] Thank you. Thank you. [23:14] Thank you. Thank you. [24:14] Thank you. Thank you. [25:14] Thank you. Thank you. [26:14] Thank you. Thank you. [26:46] Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. [26:58] Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. [27:10] Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. [27:24] Thank you. Thank you. Thank you. Thank you. Thank you. Thank you. [27:36] Thank you. Thank you. Thank you. Thank you. is is he foreign declarations and the other people who are not in the world. [28:17] I am a good person in the world. I am a good person. And I am a good person. [28:29] I am a good person. I am a good person. I am a good person. [28:41] I am a good person and I am a good person. But I am a good person. [28:52] And the good person is動 Growth which leads to COVID-19. But I thinkEM is a promise forled at times it will be looked good. [29:10] I Mannich. They were there. So, for me, I'd like to give people. They were so DELET. [29:20] I hè ra Vertigo was a member of people, Sênin c software Sơ Borop. It was two years old. [29:35] other papers like cawe r ifs interesting Christians on ENCC tion Where you at the distance ofragen does that mean a picture of110 And be forklzers from other people What's mine that's�班? [30:23] Nobody Which one would just join us? It should pop up in the single day. [30:40] And then all of those people nails in His name, in aётся form of the light. And all of his holy� Robert Paul and Gene, who told Jesus in hisBM was only a ten y dumped Round by this Tán. [31:05] For healing andken. These are quite interesting stimulies clout lindo perceive andلب invented Guys. [31:31] I was going to come and driving myself. I saw this ! I was going to drive a city college and I needed to see myself. [31:43] I got up for it even though I waslichkeit. But I wanted to practice in the future. [31:53] It would be possible to go forward in jain. C tokens like the and fashion, and fashion-yach, id opead hen i the halaf, and fashion-yach fashion-yach i the halaf. [32:20] By the way, I think, I think, I think, I think, I think, I think, I think, I think I think I think that's what I think is that it's a great thing. [32:48] I think that's what I think. But I think it's a very good thing. I think the I think that the conflict I think I think I think it's the CheIIe. [33:27] Diop pleees in the theике. [33:44] Poech reinaid Death Tippin an close it with no Джар системing with any written name that would happily spoken in on the words of the heart and your claim and the desire to speak in the eyes when the I hope you see that again. [34:24] You can rising down on the What was this changed for? [34:57] But someday was there what happened. Wasn't that much where it wasn't. Even a moment where it might go to Europe. [35:12] And we felt like so. BUT like our mentors, we have to take the ghost during our lifetime. [35:26] decision for the mothers, ogr is a mystery in all the human life. Our presentsوzelf snacks andatre, which comes through the spring of Christmas. [35:44] The power of the Lord who sins and who sins and livelihoods are becoming more I've found upon you . But the power of the devil gives me is we're right back and it's not a place where you know people causing your heart. [36:02] But animal igraliam actually feels like this. That's not too hard. I don't believe I'm right here I see all the details thing but yellow the pain Oh this journey blow the City of David's This is a ponembol drastically [37:26] Soilshin, my head of gichels, my head can't see us. Femi, I was going to say, we had a hookah. Gov, can't see us, men diallrike soilshin, astar sebi, edich urshin tjörne diallrike. [37:47] He is a knien, feemi soilshin sebi, vi had a hookah, anars, men jane, soilshin, emal sebi. He is a knien, feemi soilshin, anars, he is a rst, and now he is a rst, veis soilshin e da hookah, veis kefejkir eheilse, fatta falaf, veis soilshin, feemi soilshin, soilshin, tjörne kutjok. [38:16] He is a rjornje, veis soilshin a hookah, solus eyn aarst eichu, e chum kefejkir, ke suilshin ehe, anna sugullt ar ocho. [38:30] The chiefsi, solus eyn tjörhul, eich kdi osta dyni jeskibill. Eich anna utar bali, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha, eitha. [38:49] and they relied on it on the panna. The Gun is going to give you the Starship by and was given the Windows file for the permit. [39:11] There wasn't really nothing was written on me and then I still don't know how I come to request for brentnaf Son of God. [39:30] Again we have CBP Christians hy ooc Oh I think we are are grabbing out of Tribes hyrraud counting on personal Home of God When it altar the church has an and I think that's what I'm going to do. [40:18] I'm going to go to the news and I'm going to go to the news. So I'm going to go to the news. I'm going to go to the news. [40:33] I'm going to go to the news. [40:45] I'm going to go to the news. I'm going to go to the news. [40:58] I'm going to go to the news. I'm going to go to the news. [41:10] I'm going to go to the news. I'm going to go to the news. [41:32] This will be effective. August, the news is like that everyone is being added también and that's at the news. [41:50] Take this from behind it. The지만 will talk is the Wang. One is not realist. This is the instant gratis. [42:02] The main bakter is aotiial tank of young and this is the main noticed. It's not a country that concentratesти me. [42:19] 俺 am and on thirty i have to do it but i can essentially have to follownemark few of us or other i'm going consider Breaking reports That's not a good day He 분�ited his novel Let his mother If he's ADHD It's been a long time SOLACE speaking the current the the the and the the the the the the the the the h h link another h d gentlemen has told hi but this yes [45:01] Co'n arford etcetera. With mint tea,Speak makaravaj marium This is an abandoned This is an infection Thisocles of family So'n Back youtube musical truly adults vocal They've been already, I'm sure he doesn't have insurance you with me. [46:02] They're hot with my own fare and they're mounted. They have changed different times. They also had to wear this job to wear moreswe up, orcute them with Black wrongs, buts they have to use. [46:19] We had to get to some medication for us and the same You just re whom I wanted to get rid of you, you just what you know, to us we read that you know I'm going to say, I discussed a lot of stuff like a выглядんで in Europe, what the one is just, and the rest. [47:09] I am just coming back to Vietnam at the feed and... Nonetheless, they want to talk a bit, they want to talk with them They cannot talk for one week these stories were presidentamos... [47:53] say... Listed芋 использовать the siblings to develop resources and learn more about others than men and adults first. [48:20] Through it , this Jesus� bravamos, salud, everything is beautiful sharing about him. That is the expression in its way bigger. [48:31] Then, I opportunity to add a sword. I won't cry over any dell in Kenya. In the country I did wonder why she was aих Belsi If sobe... [48:46] did thank you in the построment of Kenya, a cooke in some of those dots is very useful. see the linkin and touch with the whole swindsrichton. [49:06] And that meeting was unprecedented. All of the lyrics, the deviations and geologically by expressing details in the words. [49:20] and the Hw. Eidhich, geallrachurge, o dhanig da hollas. Eidhich, gandionich i gea heingun, achgol gaelgog dhia, achgol mar gudim, achgol mar ania, achgol mar vishniach. [49:41] Amen. It's a nidh fachgol gudig. Iyn, trochud eishingadabaldag. Frankiekatacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacosacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacacac and . [50:36] . Amen. Amen. [51:42] Amen. Amen. [52:42] Amen. Amen. [53:42] Amen. Amen. [54:42] Amen.